View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_high_20 (Length: 269)
Name: NF3828_high_20
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 70 - 253
Target Start/End: Complemental strand, 32670473 - 32670290
Alignment:
| Q |
70 |
gagtatttgatcgtttcttcagctgaagttccacaaaggaatatcactttcttcatatagatcatcaccaagcaaatgtgatgatgaatcaatatcaaag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670473 |
gagtatttgatcgtttcttcagctgaagttccacaaaggaatatcactttcttcatatagatcatcaccaagcaaatgtgatgatgaatcaatatcaaag |
32670374 |
T |
 |
| Q |
170 |
aaagaagcacttaacaacatctgatcaacatatttaggtgattgtaaaccttctaatccataccaattagtttccgatatcata |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670373 |
aaagaagcacttaacaacatctgatcaacatatttaggtgattgtaaaccttctaatccataccaattagtttccgatatcata |
32670290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 32670530 - 32670496
Alignment:
| Q |
15 |
gaagacaaaagaattaaaattgaattgaattttgt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670530 |
gaagacaaaagaattaaaattgaattgaattttgt |
32670496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University