View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_high_26 (Length: 220)
Name: NF3828_high_26
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 31711896 - 31711694
Alignment:
| Q |
11 |
gagcagagaaaataaaagggtacctattatacttttgtacgtttgtacaacaaattggccactccatagtagtag---------gtctcactttatcann |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31711896 |
gagcagagaaaataaaagggtacctattatacttttgtacgtttgtacaacaaattggccactccatagtagtagtagtagtaggtctcactttatcatt |
31711797 |
T |
 |
| Q |
102 |
nnnnnnnn---actagagtggtccaaaagggtaaccaaaattaactttaatcaatacaaattcaactatgaaaattattccaattgaaaaataacaagaa |
198 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31711796 |
tatttatttttacttgagtggtccaaaagggtaaccaaaattaactttaatcaatacaaattcaactaggaaaattcttccaattgaaaaataacaagaa |
31711697 |
T |
 |
| Q |
199 |
acc |
201 |
Q |
| |
|
||| |
|
|
| T |
31711696 |
acc |
31711694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University