View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_low_11 (Length: 404)
Name: NF3828_low_11
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 175 - 397
Target Start/End: Complemental strand, 21872461 - 21872239
Alignment:
| Q |
175 |
tctgaaccaccttcctcttcttcttcatcctctcgaaccggaatgaaacttatcgttcctcttcaagccgtagttcaaggtcgcaacggttttctcctcg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21872461 |
tctgaaccaccttcctcttcttcttcatcctctcgaaccggaatgaaacttatcgttcctcttcaagccgtagttcaaggtcgcaacggttttctcctgg |
21872362 |
T |
 |
| Q |
275 |
gtagtttaatccctttatcactcttttactttcttcaactctaccttaaacgacgtcgttctgagaacaataacaataccccttcttctcctactacact |
374 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
21872361 |
gtagtttaatccctttgtcactcttttactttcttcaactctaccttaaacgacgtcgttctgagaacaataacaatactccttcttctcctactacgct |
21872262 |
T |
 |
| Q |
375 |
tcttcttcctcgttcttcatctc |
397 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
21872261 |
tcttcttcctcgttcttcttctc |
21872239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University