View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_low_14 (Length: 335)
Name: NF3828_low_14
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 37215143 - 37214838
Alignment:
| Q |
18 |
agtaacatgataaaatatgagtgacaacacaaagagccaaatcattgctttaaatannnnnnncttacctgagccgcgaaatcgttggagtcggaatcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215143 |
agtaacatgataaaatatgagtgacaacaccaagagccaaatcattgctttaaataattttttcttacctgagccgcgaaatcgttggagtcggaatcag |
37215044 |
T |
 |
| Q |
118 |
gtgaagaacttgtatccagccttttgattgcagcttcagtaccatcattcatttttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215043 |
gtgaagaacttgtatccagccttttgattgcagcttcagtaccatcattcatttttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctt |
37214944 |
T |
 |
| Q |
218 |
tgaaccaaagtttcctgttaatctatttaactcagccaatgatatcgagggtatctcaattggtaatactttctgtggaccaccactcttggtaatgttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37214943 |
tgaaccaaagtttcctgttaatctatttaactcagccaatgatatcgagggtatctcaattggtaatactttctgtggaccaccactcttggtaatgttg |
37214844 |
T |
 |
| Q |
318 |
ctcctt |
323 |
Q |
| |
|
|||||| |
|
|
| T |
37214843 |
ctcctt |
37214838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 23408274 - 23408217
Alignment:
| Q |
266 |
gggtatctcaattggtaatactttctgtggaccaccactcttggtaatgttgctcctt |
323 |
Q |
| |
|
|||| |||||||| |||| ||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
23408274 |
gggtgtctcaatttctaatgctttctgcggaccaccactcttgataatattgctcctt |
23408217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 52717148 - 52717091
Alignment:
| Q |
172 |
ttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctttgaaccaaagtt |
229 |
Q |
| |
|
||||||| || ||||| |||||||| ||||||||||| || |||||||| |||||||| |
|
|
| T |
52717148 |
ttgcataatacaccctcccatacgacccttcaccaatcaatgcctttgatccaaagtt |
52717091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University