View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_low_18 (Length: 271)
Name: NF3828_low_18
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 32670701 - 32670965
Alignment:
| Q |
1 |
ttgatatggattcttctacatatttgaaattatgtatcattgatgcaaagcttgttatgtcaatgtcgtgaacaaagggacgaaatacacgtagttatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32670701 |
ttgatatggattcttctacatatttgaaattatgtatcattgatgcaaagcttgttatgtcaatgtcgtgaacaaagggacgaaatacatgtagttatca |
32670800 |
T |
|
| Q |
101 |
agagtaaataaatattcctttaatcatttcttaatgcaactatgggagaaaatgttgtggttatatgtgagtaactatagggaggcctttattgcatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670801 |
agagtaaataaatattcctttaatcatttcttaatgcaactatgggagaaaatgttgtggttatatgtgagtaactatagggaggcctttattgcatgga |
32670900 |
T |
|
| Q |
201 |
aagttgttagagaaccttaaatcatattcatagagaataaggaacccctttattccgctcaactt |
265 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670901 |
aagttgttagagaagcttaaatcatattcatagagaataaggaacccctttattccgctcaactt |
32670965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University