View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3828_low_22 (Length: 268)
Name: NF3828_low_22
Description: NF3828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3828_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 51192451 - 51192290
Alignment:
| Q |
1 |
ctaaggttgatacaaacatcgtctatgacactgctaatgtcaaaagcttaggagttagaatgccgacacaaataaatttatacttgtcatgattaaataa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51192451 |
ctaaggttgatacgaacatcgtctatgacactactaatgtcaaaagcttagga-------tgccgacacaaatacatttatacttgtcatgattaaataa |
51192359 |
T |
 |
| Q |
101 |
tatataaacatattttacaaattatgagtgaaaatttacatatgcatgtaagttgtgcaatttatttca |
169 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51192358 |
tatataaacatattttacaaatcatgagtgaaaatttacatatgcatgtaaattgtgcaatttatttca |
51192290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 51212019 - 51211937
Alignment:
| Q |
174 |
tttccacaacgagtaagaatgactagaaccttagccaatgtctgggtctgaattatatttatgcacctcctaaacacaggttc |
256 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212019 |
tttccacaatgagtaagaatgactagaaccttagccaatgtctgggtctgaattatatttatgcacctcctaaacacaggttc |
51211937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University