View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3830_low_2 (Length: 251)

Name: NF3830_low_2
Description: NF3830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3830_low_2
NF3830_low_2
[»] chr3 (1 HSPs)
chr3 (1-234)||(49531924-49532157)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 49532157 - 49531924
Alignment:
1 gtgggattgaaacagtacatatgcaataaaagtttcaccagcacaagtttgataaaatccatagctaacttattaattaactactgaaataaatgagtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49532157 gtgggattgaaacagtacatatgcaataaaagtttcaccagcacaagtttgataaaatccatagctaacttattaattaactactgaaataaatgagtgt 49532058  T
101 agcaggtagggttatcttttttggctataaagatataatgtatgcatatgcaatgttgcaaacttgtgatccactctctaggcttcactatagagttggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
49532057 agcaggtagggttatcttttttggctataaagatataatgtatgcatatgcaatgttgcaaacttgtgatccactctctaggcttgactatagagttggc 49531958  T
201 atatccacatgttatttattgacaactttgttta 234  Q
    ||||||||||||||||||||||||||||||||||    
49531957 atatccacatgttatttattgacaactttgttta 49531924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University