View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3831_high_5 (Length: 249)

Name: NF3831_high_5
Description: NF3831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3831_high_5
NF3831_high_5
[»] chr4 (1 HSPs)
chr4 (174-242)||(18933529-18933597)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 18933597 - 18933529
Alignment:
174 agaaacttgtcaatccccttgttccatgctcttcgtgcttgcttgatcccatagcgcttttctgtgctc 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
18933597 agaaacttgtcaatccccttgttccatgctcttcgtgcttgcttgatcccatagcgcttttctgagctc 18933529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University