View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3831_low_6 (Length: 275)

Name: NF3831_low_6
Description: NF3831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3831_low_6
NF3831_low_6
[»] chr4 (1 HSPs)
chr4 (21-199)||(53004109-53004287)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 53004287 - 53004109
Alignment:
21 aatgatcgatggccatgtaaagcaatttctatcaaagaaaagtattgaaaataatgaaggacgtggtagggtgttcnnnnnnnnnnnatgcgatactatt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||    
53004287 aatgatcgatggccatgtaaagcaatttctatcaaagaaaagtattgaaaataatgaaggacgtggtagggtgttcttcttttttttatgcgatactatt 53004188  T
121 aatttaaagatttcaaagtgctgttatagtttcttttcagtttggattatttgatcaatttgcattaaatttcgataac 199  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53004187 aatttaaagatttcaaagtgctattatagtttcttttcagtttggattatttgatcaatttgcattaaatttcgataac 53004109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University