View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3832_high_6 (Length: 291)
Name: NF3832_high_6
Description: NF3832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3832_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 276
Target Start/End: Original strand, 15182035 - 15182303
Alignment:
| Q |
7 |
ataaatcacattaatcatctcatgttcttcaacttgctgcattgtcgccgcgttacaaaaataggaaggaaaatacattgtgcgagtcttttcacttgtt |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15182035 |
ataaatcacattaattatctcatgttcttcaacttgctgcattgtcgccgcgttacaaaaacaggaaggaaaatacattgtacgagtcttttcacttgtt |
15182134 |
T |
 |
| Q |
107 |
gtgcataactttgccaaattatccattcttatccaccaaattaagtttctttaagtcattagtttttcaatcaatatattcctaatttg---tatcatag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15182135 |
gtgcataactttgccaaattatccattcttatccaccaaattaagtttctttaagtcattagtttttcaatcaatatattcctaatttgtactatcatag |
15182234 |
T |
 |
| Q |
204 |
tttctttaatttgtatcatatttggtttaannnnnnnnnnnaacaatgcctttttcgaacttcactatgtaga |
276 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
15182235 |
tttctttaatttgtatcatatttggtgtaa----tttttttaacaatacctttttcgaacttcactatgtaga |
15182303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University