View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3832_low_6 (Length: 295)
Name: NF3832_low_6
Description: NF3832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3832_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 290
Target Start/End: Complemental strand, 31594070 - 31593799
Alignment:
| Q |
14 |
caaacacttatacatggatggagagttatgtctttgttggatgatcttaggaattttcttcgaacgattcccaaccatttcttggatacgcccattttag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31594070 |
caaacacttatacatggatggagagttatgtctttgttggatgatcttaggaattttcttcgaacgattcccaaccatttcttggatacgcccattttag |
31593971 |
T |
 |
| Q |
114 |
cttgtatacttttagtttggaatgtgaattgaattaatacatacatgtacacccatttgttataggtccaccacatcttagtaatcacattaaaaaatgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31593970 |
cttgtatacttttagtttggaatgtgaatt-----aatacatacatgtacacccatttgttataggtccaccacatctgattaatcacattaaaaaatgt |
31593876 |
T |
 |
| Q |
214 |
ggataattcaattgaataaatgattaatgtttgatgctttttggaagggttataggtgattggattatgtttctgtg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31593875 |
ggataattcaattgaataaatgattaatgtttgatgctttttggaagggttataggtgattggattatgtttatgtg |
31593799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University