View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3833_high_10 (Length: 336)
Name: NF3833_high_10
Description: NF3833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3833_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 54498293 - 54498059
Alignment:
| Q |
18 |
tgcagaactcatataatttggaagggggttcagatgatatcgaacaggcattgtcagctgctttctacggagacaaatctgcaatctttaacagtagttt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498293 |
tgcagaactcatataatttggaaggaggttcagatgatatcgaacaggcattgtcagctgctttctacggagacaaatctgcaatctttaacagtagttt |
54498194 |
T |
|
| Q |
118 |
tatgagttatcaagatactttgattgcagcaaagggacgacactactttaaagac-tgttatgttatattcaaggtgatgtcgactttatttttggttct |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498193 |
tatgagttatcaagatactttgtttgcagcaaagggacgacactactttaaagacatgttatgttatattcaaggtgatgtcgactttatttttggttct |
54498094 |
T |
|
| Q |
217 |
ggccaatcttattttgaggtaaaacatagacacac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498093 |
ggccaatcttattttgaggtaaaacatagacacac |
54498059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 18744418 - 18744478
Alignment:
| Q |
178 |
tgttatattcaaggtgatgtcgactttatttttggttctggccaatcttattttgaggtaa |
238 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
18744418 |
tgttatattcaaggtgaagttgacttcatttttggtcaagcccaatcttattttgaggtaa |
18744478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University