View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3833_high_13 (Length: 280)
Name: NF3833_high_13
Description: NF3833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3833_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 66 - 263
Target Start/End: Original strand, 27922253 - 27922449
Alignment:
| Q |
66 |
ataaaaaatataattttgatccaagcatttgaatgagagatgttaagggatctcttccatgttagcaagagtccaaaagttcgaatttaaatatgagaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
27922253 |
ataaaaaatataattttgatccaagcatttgaatgagagatgtcaagggatctcttccatgttagcaagagtctaaaagttcgaatttaagtatgagaat |
27922352 |
T |
 |
| Q |
166 |
gtatcggtgctaaatcttttaagannnnnnnnnnnncattatccttttatccaatttgatggattaatttatacaatacgcgtagatgatatctgatt |
263 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27922353 |
gtatcggtgctaaatcttttaaga-ttttttttttccattatccttttatccaatttaatggattaatttatacaatacgcgtcgatgatatctgatt |
27922449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University