View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3833_low_19 (Length: 218)
Name: NF3833_low_19
Description: NF3833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3833_low_19 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 218
Target Start/End: Original strand, 52220484 - 52220566
Alignment:
| Q |
136 |
cttgaatgatttggataagaattcataaagtagggtttataacagatataattaaataaaaccccaacaaaaacggtaatcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52220484 |
cttgaatgatttggataagaattcataaagtagggtttataacagatataattaaataaaaccccaacaaaaacggtaatcaa |
52220566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 52220352 - 52220415
Alignment:
| Q |
1 |
taaagagaaacatgcaatgaacacaagcaatttgtgattcaaaattgaaactcaaaacccacat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52220352 |
taaagagaaacatgcaatgaacacaagcaatttgtgattcaaaattgaaactcaaaacccacat |
52220415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University