View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3834_high_13 (Length: 236)
Name: NF3834_high_13
Description: NF3834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3834_high_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 2960059 - 2959839
Alignment:
| Q |
16 |
atatttattaggaagaaggctgctgagagacgggcacaacttgttgagctggatgactcatagaatatgaaataagagccatctcatatgtgatgatgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2960059 |
atatttattaggaagaaggctgctgagagacgggcacaacttgttgagctggatgactcatagaatatgaaataagagccatctcatatgtgatgatgtg |
2959960 |
T |
|
| Q |
116 |
agcaacaattcctgcggttgtagtatcaaatgctcttttttgacattcacagctgatatcattgcggaagttttgtagcatgagtagacataatatcatt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2959959 |
agcaacaattcctgcggttgtagcatcaaatgctcttttttgacattcacagctgatatcattgcggaagttttgtagcatgagtagacataatatcatt |
2959860 |
T |
|
| Q |
216 |
gattgaattattttgtgcagc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2959859 |
gattgaattattttgtgcagc |
2959839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University