View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3834_low_10 (Length: 238)
Name: NF3834_low_10
Description: NF3834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3834_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 24570016 - 24569816
Alignment:
| Q |
1 |
ttaattaattgaaacattat--cttttaattctataatcagtcagcaagcgatagcgttgatgttttcactggggtcgttcttatgcatgacaattgtgc |
98 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24570016 |
ttaattaattgaaacattatgtcttttaattctatagtcagtcagcaagcgatagtgttgatgttttcactggggtcgttcttatgtatgacaattgtgc |
24569917 |
T |
|
| Q |
99 |
atgtggtcaaaaggtgcatttctttcgttaatctctttggcgtcagtatcatcatgctctttgatcccggtggaagtcacagttttccgttgtcaacctt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24569916 |
atgtggtcaaaaggtgcatttctttcgttaatctctttggcgtcagta---tcatgctctttgatcccggtggaagtcacagttttccgttgtcaacctc |
24569820 |
T |
|
| Q |
199 |
gttg |
202 |
Q |
| |
|
|||| |
|
|
| T |
24569819 |
gttg |
24569816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University