View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3834_low_12 (Length: 238)
Name: NF3834_low_12
Description: NF3834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3834_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 42456205 - 42456305
Alignment:
| Q |
18 |
gtcagatcagaaacaactttattgtatttcacaatcaatctccctatatgaaggtgacctttctaactttgtatccatcatcgaatggttgtgaactcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42456205 |
gtcagatcagaaacaactttattgtatttcacaatcaatctccctacatgaaggtgacctttctaactttgtatccatcatcgaatggttgtgaactcca |
42456304 |
T |
 |
| Q |
118 |
a |
118 |
Q |
| |
|
| |
|
|
| T |
42456305 |
a |
42456305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 42456360 - 42456417
Alignment:
| Q |
174 |
catgtatcttgacatcaattgagtgttccagaaatccttcttcaatgattcgagacac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42456360 |
catgtatcttgacatcaattgagtgttccagaaatccttcttcaatgattcgagacac |
42456417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University