View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3834_low_8 (Length: 250)
Name: NF3834_low_8
Description: NF3834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3834_low_8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 86 - 250
Target Start/End: Complemental strand, 24570225 - 24570061
Alignment:
| Q |
86 |
attgaaaaccttttgaaataattgtacaactaatctattcatgatgcgatgaattgaatatctctatgtgggctattatatgataattgttaaatgcgtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24570225 |
attgaaaaccttttgaaataattgtacaactaatctatgcatgatgcgatgaattgaatatctctatgtgggctattatatgataattgttaaatgcgtt |
24570126 |
T |
|
| Q |
186 |
tatgtgatatgtgtgacgaatcttctcgaatcttttataatttattttaggattttatagatgac |
250 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24570125 |
tatgtgatatgtgtgacgactcttctcgaatcttttataatttattttaggattttatagatgac |
24570061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 24571010 - 24570931
Alignment:
| Q |
12 |
aaaggaataagtgtcaagtgtgagaaaatatcatgtgtcttcttcattcaaaattgtacgagctgataattttcattgaaaac |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24571010 |
aaaggaataagtgtcaaatgtgagaaaatatcatgtgt---cttcattcaaaatttctcgagctgataattttcattgaaaac |
24570931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University