View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3836_high_4 (Length: 305)
Name: NF3836_high_4
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3836_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 12 - 287
Target Start/End: Complemental strand, 9937304 - 9937023
Alignment:
| Q |
12 |
agagaggttccccaagaaaggggg--tgggtatgatgttgaagcaattgattaaatttatgcaaaaattgaagctttatcaatnnnnnnnnttgtgataa |
109 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9937304 |
agagcggttccccaagaaagggggggtgggtatgatgttgaagcaattgattagatttatgcaaaaattgaagctttatcaatcaaagaaagtgtgataa |
9937205 |
T |
 |
| Q |
110 |
aaaa---tgtgttaaaatatgtgttgctgacatttcnnnnnnnn--ataggaatcaaaaccttcaatggtcggttagatcacctgtttatccaaaaggac |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9937204 |
aaaaatatgtgttaaaatatgtgttgctgacatttctctttttcttataggaatcaaaactttcaatggtcggttagatcacctgattatccaaaaggac |
9937105 |
T |
 |
| Q |
205 |
aaaataacccataaaaatccaatttagagttaacgttggagaattttgttttgacacaaacaaaacaagatgaaagattttaa |
287 |
Q |
| |
|
|||| |||||| || |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9937104 |
aaaacaacccacaagaatccaatttagagttaatgttggagaatttcgttttgacacaaacaaaacaagatg-aagattttaa |
9937023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University