View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3836_low_10 (Length: 229)
Name: NF3836_low_10
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3836_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 4 - 226
Target Start/End: Complemental strand, 38948116 - 38947889
Alignment:
| Q |
4 |
tacatcttattttattctagtgtaatatgagtcatccaatctaaaattaacaatgtaaatcatttacaatgtg----------aaatttgtgcgagacan |
93 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||||||||||||||||| ||||||||||| ||| |||||||| ||||||| |
|
|
| T |
38948116 |
tacatcttattttattctggtgtaatatgagtcattcgatctaaaattaacaatgtagatcatttacaacgtgaaattgcgtgaaatttgtacgagacat |
38948017 |
T |
 |
| Q |
94 |
nnnnnnnnnnnnnnnagagatggggttagagacattgaaagttaaaattaacaaaaagtattatttgaagtcttaatgatagattttgatgataaccatt |
193 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38948016 |
tttttttttttttg-agagatggtgttagagacattgaaagttaaaa----caaaaagtattattttaagtcttaatgatagattttgatgataaccatt |
38947922 |
T |
 |
| Q |
194 |
aaccatgttacaaggtccttcagcttctctgct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38947921 |
aaccatgttacaaggtccttcagcttctctgct |
38947889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University