View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3836_low_11 (Length: 224)

Name: NF3836_low_11
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3836_low_11
NF3836_low_11
[»] chr2 (2 HSPs)
chr2 (82-202)||(28125309-28125429)
chr2 (11-39)||(28128514-28128542)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 82 - 202
Target Start/End: Complemental strand, 28125429 - 28125309
Alignment:
82 ctttcttgaacagataaaacttgattcaaatatgcttttaaatcatataaatataacattttttcagtctccttaatttttaatatattacattaatcaa 181  Q
    ||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||    
28125429 ctttcttgaacagataaaacttggttcaaatatgcttttaaatcctataaatatagcattttttcagtctttttaattttttatatattacattaatcaa 28125330  T
182 tttcaatataaataagtttta 202  Q
    ||||||||||||||| |||||    
28125329 tttcaatataaataaatttta 28125309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 39
Target Start/End: Complemental strand, 28128542 - 28128514
Alignment:
11 tcatcaactttgttgctattcaaatcata 39  Q
    |||||||||||||||||||||||||||||    
28128542 tcatcaactttgttgctattcaaatcata 28128514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University