View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3836_low_11 (Length: 224)
Name: NF3836_low_11
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3836_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 82 - 202
Target Start/End: Complemental strand, 28125429 - 28125309
Alignment:
| Q |
82 |
ctttcttgaacagataaaacttgattcaaatatgcttttaaatcatataaatataacattttttcagtctccttaatttttaatatattacattaatcaa |
181 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
28125429 |
ctttcttgaacagataaaacttggttcaaatatgcttttaaatcctataaatatagcattttttcagtctttttaattttttatatattacattaatcaa |
28125330 |
T |
 |
| Q |
182 |
tttcaatataaataagtttta |
202 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
28125329 |
tttcaatataaataaatttta |
28125309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 39
Target Start/End: Complemental strand, 28128542 - 28128514
Alignment:
| Q |
11 |
tcatcaactttgttgctattcaaatcata |
39 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28128542 |
tcatcaactttgttgctattcaaatcata |
28128514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University