View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3836_low_12 (Length: 212)
Name: NF3836_low_12
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3836_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 197
Target Start/End: Complemental strand, 33401274 - 33401084
Alignment:
| Q |
7 |
ggaggagcagagagtgtgattctatcaaccacaacatggattggtggaaaaaatgatttcttggggattgcatatattctcattggtggactttccttgg |
106 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401274 |
ggaggaacaaagagtgtgattctatcaaccacaacatggattggtggaaaaaatgatttcttggggattgcatatattctcattggtggactttccttgg |
33401175 |
T |
|
| Q |
107 |
tgtactctctagttttcctacttatgtatttgatgaagccaaggtgaggaaaaactatacattcttcatcatctttatacattatggtttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401174 |
tgtactctctagttttcctacttatgtatttgatgaagccaaggtgaggaaaaactatacattcttcatcatctttatacattatggtttt |
33401084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University