View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3836_low_7 (Length: 248)
Name: NF3836_low_7
Description: NF3836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3836_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33401592 - 33401831
Alignment:
| Q |
1 |
tttaggataaacatcagacccaaatttggcctgttggtcacttttccatgctatattctttttgttaatcaccaagtccttattattgtttgaaaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401592 |
tttaggataaacatcagacccaaatttggccttttggtcacttttccatgctatattctttttgttaatcaccaagtccttattattgtttgaaaatctg |
33401691 |
T |
 |
| Q |
101 |
tatgtgtcattgaatagactccatgcagcaaggccgcaaggaacaaccggaagataaccatttgcagtatagtcttcaggaaagcatttgcctacatcat |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401692 |
tatgtgtcattgaatagactccaagcagcaaggccacaaggaacaaccggaagataaccatttgcagtatagtcttcaggaaagcatttgcctacatcat |
33401791 |
T |
 |
| Q |
201 |
tctcatctgccttactcctcaattgtttatgatctctgct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401792 |
tctcatctgccttactcctcaattgtttatgatctctgct |
33401831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University