View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3837_high_8 (Length: 250)
Name: NF3837_high_8
Description: NF3837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3837_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 46618846 - 46618605
Alignment:
| Q |
1 |
agttcttaacaaaaagatacattctttaatgctatgtttcaaatcaaagtgtatattaatgcgtcaatcaacccattcaatcataaaaatagcacgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618846 |
agttcttaacaaaaagatacattctttaatgctatgtttcaaatcaaagtgtatattaatgcgtgaatcaacccattcaatcataaaaatagcacgttct |
46618747 |
T |
|
| Q |
101 |
attaatcacacctttatagtcttctctttaatgtaatcattttagaaatctcaccacataaactttccacttttttatcacagcattgtgttcatgatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618746 |
attaatcacacctttatagtcttctctttaatgtaatcattttagaaatctcaccacat-aactttccacttttttatcacagcattgtgttcatgatgt |
46618648 |
T |
|
| Q |
201 |
gattattaatcacgctgcaattgtttttcctattcctttgcta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618647 |
gattattaatcacgctgcaattgtttttcctattcctttgcta |
46618605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University