View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3837_low_12 (Length: 206)
Name: NF3837_low_12
Description: NF3837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3837_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 144
Target Start/End: Original strand, 36465574 - 36465700
Alignment:
| Q |
16 |
attattcttcatgtatttcatgattgcattcacgcaatccaagtatagcttcgtatggtttcctacgattttataactannnnnnnnnnaattgaagggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
36465574 |
attattcttcatgtatttcatgattgcattcacgcaatccaagtatagcttcgtatagtttcctacgattttataacta--ttttttttaattgaagggg |
36465671 |
T |
 |
| Q |
116 |
ttggtttttaattgggcatggattgtata |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36465672 |
ttggtttttaattgggcatggattgtata |
36465700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 183
Target Start/End: Original strand, 36465689 - 36465728
Alignment:
| Q |
144 |
atggattgtataagttcaccgtattcagaagctgttaaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36465689 |
atggattgtataagttcaccgtattcagaagccgttaaaa |
36465728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University