View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3837_low_7 (Length: 251)
Name: NF3837_low_7
Description: NF3837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3837_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 46619180 - 46618945
Alignment:
| Q |
18 |
catagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatctatatccattcaaactcaccacagcataaaccagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46619180 |
catagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatctatatccattcaaactcaccacagcataaaccagaa |
46619081 |
T |
 |
| Q |
118 |
ctttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcgtgtgcgaac-aataagttttaggttcgatttacc-nnnnnnnnnnna |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||| | |
|
|
| T |
46619080 |
ctttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcatgtgcgaacaaataaattttaggttcgatttaccttcatttttttta |
46618981 |
T |
 |
| Q |
216 |
gtgataaatataagtaattagttgttagattaattt |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46618980 |
gtgatgaatataagtaattagttgttagattaattt |
46618945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University