View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3838_high_10 (Length: 309)
Name: NF3838_high_10
Description: NF3838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3838_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 4031193 - 4031117
Alignment:
| Q |
12 |
atctttatctttatctttattattaacatttgcaaagatcctagcaatttcaagttgtgtattagcaataatttcag |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031193 |
atctttatctttatctttattattaacatttgcaaagatcctagcaatttcaagttgtgtattagcaataatttcag |
4031117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 169 - 226
Target Start/End: Complemental strand, 4031036 - 4030979
Alignment:
| Q |
169 |
gtttgttctgatctcactaccacctctgctacccaccttatgctttctgctattccca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031036 |
gtttgttctgatctcactaccacctctgctacccaccttatgctttctgctattccca |
4030979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University