View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3838_high_16 (Length: 229)
Name: NF3838_high_16
Description: NF3838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3838_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 36 - 210
Target Start/End: Original strand, 6701181 - 6701355
Alignment:
| Q |
36 |
tgcacatacctgttctggccggagaaaaacaacattccccaaaacgatgacgtttccagattcatccaatatctttgcaaactcaacaccttgttcatga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701181 |
tgcacatacctgttctggccggagaaaaacaacattccccaaaacgatgacgtttccagattcatccaatatctttgcaaactcaacaccttgttcatga |
6701280 |
T |
|
| Q |
136 |
ttctcacacgattcaacacagatcctcaaaaactcaccgtaactaactgaattctccgaaacctctctcagtttc |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701281 |
ttctcacacgattcaacgcagatcctcaaaaactcaccgtaactaactgaattctccgaaacctctctcagtttc |
6701355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University