View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3838_low_6 (Length: 381)
Name: NF3838_low_6
Description: NF3838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3838_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 14511383 - 14511120
Alignment:
| Q |
19 |
ggtatttctcttatgggcggcctattactcattatttcagatcgtcggtttggttgggcatgaaacctatggttggcatggtgctggataattcagtttg |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14511383 |
ggtatttctcttattggcggcctattactcattatttcagatcttcggtttggttgggcatgaaatctatggttggcatggtgctggataattcagtttg |
14511284 |
T |
|
| Q |
119 |
gattgtcggtaatggggagaagattaatttttggatggacaactagttaggtgctcccttagttgatactttgcagatttcggtggagttttgtttgaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14511283 |
gattgtcggtaatggggagaagattaatttttggacggacaactatttaggtgctcccttagttgatactttgcagatttcggtggagttttgtttgaga |
14511184 |
T |
|
| Q |
219 |
cagttcacgtggctattcgtaatggtcagattgagcttcctgcgttcgtgcgggataattctac |
282 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14511183 |
cagttcacatggctattcgtaatggtcagattgagcttcctgtgttcgtgcgggataattctac |
14511120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 294 - 371
Target Start/End: Original strand, 54189027 - 54189104
Alignment:
| Q |
294 |
agaacaatttcaatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
371 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54189027 |
agaacaatttcgatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
54189104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 294 - 371
Target Start/End: Complemental strand, 8570186 - 8570109
Alignment:
| Q |
294 |
agaacaatttcaatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
371 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8570186 |
agaacaatttcgatgaagggattgcgaagaggagcgattgtgatgaagatgtgagtgtgattgaaatgaaactgatga |
8570109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 294 - 371
Target Start/End: Original strand, 3368120 - 3368197
Alignment:
| Q |
294 |
agaacaatttcaatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
371 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3368120 |
agaacaatttcgatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
3368197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 298 - 371
Target Start/End: Original strand, 9891773 - 9891846
Alignment:
| Q |
298 |
caatttcaatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
371 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9891773 |
caatttcgatgaagggattgtgaagaagagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
9891846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 294 - 371
Target Start/End: Complemental strand, 28696146 - 28696069
Alignment:
| Q |
294 |
agaacaatttcaatgaagggattgcgaagaggagcgattgtgatgaagatgtgagagtgattgaaatgaaactgatga |
371 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28696146 |
agaacaatttcgatgaagggattgcgaagaggagcgattgtgatgaagatgtgagtgtgattgaaatgaaactgatga |
28696069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 218 - 277
Target Start/End: Original strand, 14271944 - 14272003
Alignment:
| Q |
218 |
acagttcacgtggctattcgtaatggtcagattgagcttcctgcgttcgtgcgggataat |
277 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
14271944 |
acagttcaaatggctattcacaatggtcagattgagcttcttgcttttgtgcgggataat |
14272003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 15143423 - 15143382
Alignment:
| Q |
111 |
tcagtttggattgtcggtaatggggagaagattaatttttgg |
152 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
15143423 |
tcagtttggattgttggtactggtgagaagattaatttttgg |
15143382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University