View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3839_high_5 (Length: 331)
Name: NF3839_high_5
Description: NF3839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3839_high_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 56 - 331
Target Start/End: Original strand, 13591366 - 13591641
Alignment:
| Q |
56 |
ccataccccaaaccctccgtgatttccttctcaatcggcactacggattcattaggtttaagaaccccatgctacgaaacatgcttaagtcatcgaagca |
155 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13591366 |
ccataccgcaaaacctccgtgatttccttctgaatcggcactgcggattcattaggtttaagaaccccatgctacgaaacatgcttaagtcatcgaagca |
13591465 |
T |
 |
| Q |
156 |
ctgtttggagattcatagagatcctttagatctctcgttctacagagaagagtacgatcatgattcagtggaagagattatttataaaagccttggattg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13591466 |
ctgtttggagattcatagagatcctttagatctctcgttctacagagaagagtacgatcatgattcagtggaagagattatttataaaagccttggattg |
13591565 |
T |
 |
| Q |
256 |
aaagtggagcttagagaagagattagaatgagtaattggagtgaagagtgtcttagtgatgatcaacttgcctatg |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13591566 |
aaagtggagcttagagaagagattagaatgagtaattggagtgaagagtgtcttagtgatgatcaacttgcttatg |
13591641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University