View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3839_low_12 (Length: 242)
Name: NF3839_low_12
Description: NF3839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3839_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 164
Target Start/End: Complemental strand, 7560257 - 7560104
Alignment:
| Q |
14 |
agcagagataaaaagtaaacactatcaattcagtagttttaacaatatactaaacactgcatccgacggagtaaacaaattcaaatatagttcaagacat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7560257 |
agcagagataaaaagtaaacactatcaattcagtagttttaacaatatagtaaacactgcatccgacggagtaaacaaattcaaatatatttcaagacat |
7560158 |
T |
 |
| Q |
114 |
ctgttttgaagaatgtaaggttttc---agctctctcaaatttcagcaagtgtt |
164 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7560157 |
ctgttttgaagaatgtaaggttttcagaagctctctcaaatttcagcaagtgtt |
7560104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University