View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3839_low_4 (Length: 353)
Name: NF3839_low_4
Description: NF3839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3839_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 49816858 - 49817193
Alignment:
| Q |
1 |
ctgaaccggttgaatggctccttgataagaattgtagagaacgaatcaatctattttgacgagctgtatcgaaattcaaactgctgcttcttttgaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49816858 |
ctgaaccggttgaatggctccttgataagaattgtagagaacgaatcaatctattttgacgagctgtatcaaaattcaaactgctgcttcttttgaattg |
49816957 |
T |
 |
| Q |
101 |
ccagaaatgtttggataacaatggcttctcttcttccacgtctgtttcatcagacagaaattctttaagcctcttcttcattactgtagttttttgaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49816958 |
ccagaaatgtttggataacaatggcttctcttcttccacgtctgtttcatcagacaggaattctttaagcctcttcttcattactgtagttttttgaaga |
49817057 |
T |
 |
| Q |
201 |
ggctcaaagagttcattagctgatgaatttttctttattggaacgataattccattggagataacnnnnnnnatttccattggaactatttttccatcgg |
300 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49817058 |
ggctcaaagaattcattagctgatgaatttttcttcattggaacgataattccattggagataactttttttatttccattggaactatttttccatcgg |
49817157 |
T |
 |
| Q |
301 |
agaaaagttcatcagctgaagaaaattgctgagaaa |
336 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49817158 |
agaaaagttcatcagctgaagagaattgctgagaaa |
49817193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University