View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3840_high_8 (Length: 216)
Name: NF3840_high_8
Description: NF3840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3840_high_8 |
 |  |
|
| [»] chr6 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 33223774 - 33223558
Alignment:
| Q |
1 |
gagttgaaaagtctggtgcagtgacagtagcacactattatgctacttgtagagattgnnnnnnnnataatgatgccgggattttttcnnnnnnn-gttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
33223774 |
gagttgaaaagtctggtgcagtgacagtagcacactattatgctacttgtacagattgttttttttataatgatgccgggattttttcaaaaaaaagttg |
33223675 |
T |
 |
| Q |
100 |
atgtctggctttcaacggaagtagttattactgtgttaaacaataatggtttggatgtttcaatgaagggtccttttgaacacccttctatgacattgct |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223674 |
atgtcgggctttcaacggaagtagttattactgtattaaacaataatggtttggatgtttcaatgaagggtccttttgaacacccttctatgacattgct |
33223575 |
T |
 |
| Q |
200 |
tcaaatgtttcaacaag |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33223574 |
tcaaatgtttcaacaag |
33223558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 33226708 - 33226664
Alignment:
| Q |
1 |
gagttgaaaagtctggtgcagtgacagtagcacactattatgcta |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33226708 |
gagttgaaaagtctggtgcagtgagagtagcacactattatgcta |
33226664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 216
Target Start/End: Original strand, 33245920 - 33245992
Alignment:
| Q |
144 |
aatggtttggatgtttcaatgaagggtccttttgaacacccttctatgacattgcttcaaatgtttcaacaag |
216 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||| || ||| |||||||||||| |||||| |
|
|
| T |
33245920 |
aatgatttggatgtttcaatgaaggatccttatgaacacccttctttggtattccttcaaatgtttgaacaag |
33245992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 216
Target Start/End: Complemental strand, 33226543 - 33226474
Alignment:
| Q |
152 |
ggatgtttcaatgaagggtccttttgaacacccttct-----atgacattgcttcaaatgtttcaacaag |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
33226543 |
ggatgtttcaatgaagggtccttctgaacacccttctaagaaaagaaattgcttcaaatgtttcaacaag |
33226474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 151
Target Start/End: Complemental strand, 33226593 - 33226558
Alignment:
| Q |
116 |
ggaagtagttattactgtgttaaacaataatggttt |
151 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33226593 |
ggaagtagttattactgtggtaaacaataatggttt |
33226558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University