View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3840_low_8 (Length: 262)
Name: NF3840_low_8
Description: NF3840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3840_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 252
Target Start/End: Original strand, 39473635 - 39473884
Alignment:
| Q |
5 |
tttgtcttatgctaaatgatctattttctttagtgtttactatttgaaaattacttttaagtttactttttagatatct--gtcaaatacannnnnnnnn |
102 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39473635 |
tttgtctgatgctaaatgatctattttctttagtgtttactattttaaaattacttttaagtttactttttagatatctttgtcaaatacattttttttt |
39473734 |
T |
|
| Q |
103 |
gtatagcagtttccaaatgattctatcgatttcattctcatccataggaataaaaaattattgaaaagttaaaaatatgtcaacaaagaagttctgcact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39473735 |
gtatagcagtttccaaatgattctatcgatttcattctcatccataggaataaaaaattattgaaaagttaaaaatatgtcaacaaagaagttctgcact |
39473834 |
T |
|
| Q |
203 |
gcattgaaaaaatatacattactactattactattctcttcaactctctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39473835 |
gcattgaaaaaatatacattactactattactactctcttcaactctctg |
39473884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 60
Target Start/End: Original strand, 39465635 - 39465669
Alignment:
| Q |
26 |
tattttctttagtgtttactatttgaaaattactt |
60 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39465635 |
tattttctttagtgtttactaattgaaaattactt |
39465669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University