View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3840_low_9 (Length: 228)
Name: NF3840_low_9
Description: NF3840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3840_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 43540690 - 43540488
Alignment:
| Q |
9 |
tagaattatacatgctatgctatgatattaatttaaagaaagccataattaacttgacttgcctgaaaagcaaatacactgatgaaagaagttgcatttt |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540690 |
tagaattatacctgctatgctatgatattaatttaaagaaagccataattaacttgacttgcctgaaaagcaaatacactgatgaaagaagttgcatttt |
43540591 |
T |
|
| Q |
109 |
gagtgatatttactttgtgattggcattcatccataaaagcatcaatctcatacacaaacaattcaccattgtaaatcaatgtaacatcacatgtctttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540590 |
gagtgatatttactttgtgattggcattcatccataaaagcatcaatctcatacacaaacaattcaccattgtaaatcaatgtaacatcacatgtctttg |
43540491 |
T |
|
| Q |
209 |
gtg |
211 |
Q |
| |
|
||| |
|
|
| T |
43540490 |
gtg |
43540488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University