View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3841_low_4 (Length: 345)
Name: NF3841_low_4
Description: NF3841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3841_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 166 - 329
Target Start/End: Original strand, 39306734 - 39306897
Alignment:
| Q |
166 |
cagctggaacgtctctttcaatttttaatgatgattgaaaaaattggatgatacttcgtgctaattatgaggtggcggatgaggatgtttgcagagtagg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306734 |
cagctggaacgtctctttcaatttttaatgatgattgaaaaaattggatgatacttcgtgctaattatgaggtggcggatgaggatgtttgcagagtagg |
39306833 |
T |
|
| Q |
266 |
caagtccattctagtgggttttagaagggtgagatgacgtaagtgataaaattagagtggaggg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
39306834 |
caagtccattctagtgggttttagaagggtgaggtgaggtaagtggtaaaattagagtggaggg |
39306897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 15 - 144
Target Start/End: Original strand, 39306139 - 39306268
Alignment:
| Q |
15 |
ggtagaggatttaaattttggtttagctgaagatgcatgtttagttgatttgaagaagaggttgatagagaatctgtttattctgagccacactgtttgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306139 |
ggtagaggatttaaattttggtttagctgaagatgcatgtttagttgatttgaagaagaggttgatagagaatctgtttattctgagccacactgtttgc |
39306238 |
T |
|
| Q |
115 |
aagatgatgttcaagttgttgaaacactaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39306239 |
aagatgatgttcaagttgttgaaacactaa |
39306268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University