View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3841_low_7 (Length: 228)
Name: NF3841_low_7
Description: NF3841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3841_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 43142625 - 43142426
Alignment:
| Q |
17 |
actttgacacagaagttttgctggttccatcacggtaacggggtataaaaaaccaaacttaaaatgagtttaaggttgcaaagcttaatagcaaatgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142625 |
actttgacacagaagttttgctggttccatcacggtaacggggtataaaaaaccaaacttaaaatgagtttaaggttgcaaagcttaatagcaaatgatt |
43142526 |
T |
 |
| Q |
117 |
aaaaacatgaatgcagaaatgggaggaaatatggactttattatacctcaaattctgatattagtcgtgatataggatggtaagccggatcctctgtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142525 |
aaaaacatgaatgcagaaatgggaggaaatatggactttattatacctcaaattctgatattagtcgtgatataggatggtaagccggatcctctgtgct |
43142426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 216
Target Start/End: Complemental strand, 43154510 - 43154404
Alignment:
| Q |
110 |
aatgattaaaaacatgaatgcagaaatgggaggaaatatggactttattatacctcaaattctgatattagtcgtgatataggatggtaagccggatcct |
209 |
Q |
| |
|
|||||||| ||| ||||| ||||||||| | |||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
43154510 |
aatgattagaaaagtgaatttagaaatgggggaaaatgtggacttatttatacctcaaattctgatattagtcgtgatatagcatggtaagcaggatcct |
43154411 |
T |
 |
| Q |
210 |
ctgtgct |
216 |
Q |
| |
|
||||||| |
|
|
| T |
43154410 |
ctgtgct |
43154404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University