View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3842_low_4 (Length: 295)
Name: NF3842_low_4
Description: NF3842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3842_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 11975833 - 11975562
Alignment:
| Q |
10 |
agaagcataggagaagacgggggaggagacggagttggaaccggctatagttgggagnnnnnnngaaattatagatcaacttatcccgctccacacagga |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975833 |
agaagcatgggagaagacgggggaggagacggagttggaaccggctatagttgggagaaaaaaagaaattatagatcaacttatcccgctccacacagga |
11975734 |
T |
|
| Q |
110 |
gctgaatccgttgggaaagtttctgtggtttccattgttgggttcgcaggaatagggaagacaaaacttgcccgtcttatttgtgaggatgagcaagtca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975733 |
gctgaatccgttgggaaagtttctgtggtttccattgttgggttcgcaggaatagggaagacaaaacttgcccgtcttatttgtgaggatgagcaagtca |
11975634 |
T |
|
| Q |
210 |
aagctcacttcggccttcaaatttggatttatgatgtggaattcctcaataccactgacatgtcatctactt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975633 |
aagctcacttcggccttcaaatttggatttatgatgtggaattcctcaataccactgacatgtcatctactt |
11975562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 11730841 - 11730896
Alignment:
| Q |
158 |
ggaatagggaagacaaaacttgcccgtcttatttgtgaggatgagcaagtcaaagc |
213 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||| |||||||||||||||||||| |
|
|
| T |
11730841 |
ggaatagggaagacaaaacttgcacggcttgtttgcgaggatgagcaagtcaaagc |
11730896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 11730395 - 11730452
Alignment:
| Q |
156 |
caggaatagggaagacaaaacttgcccgtcttatttgtgaggatgagcaagtcaaagc |
213 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
11730395 |
caggaataggaaagacaaaacttgcacgtcttgtttgcaaggatgagcaagtcaaagc |
11730452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University