View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_high_15 (Length: 256)
Name: NF3843_high_15
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 25035517 - 25035747
Alignment:
| Q |
1 |
ataatctattgtagcagctgcaaattatttttgtcttatgtattttcataggaagaaaattctatgcgaacctacgatgcaagggtaaatgccctaggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25035517 |
ataatctattgtagcagctgcaaattatttttgtcttatgtattttcataggaagaaaattctatgcgaacctacgatgcaagggtaaatgccctaggtc |
25035616 |
T |
|
| Q |
101 |
gatccactaattacagatggatcattaaggatattaaggtttagtttataatattaatttcatctctatgattatatttcttttctttcaatccttagtc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25035617 |
gatccactaattacaggtggatcattaaggatattaaggtttagtttataatattaattccatctctatgattatatttcttttctttcaatccttagtc |
25035716 |
T |
|
| Q |
201 |
ttgcaatttcgatttctgattattggttaac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25035717 |
ttgcaatttcgatttctgattattggttaac |
25035747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 231
Target Start/End: Original strand, 22656423 - 22656532
Alignment:
| Q |
122 |
tcattaaggatattaaggtttagtttataatattaatttcatctctatgattatatttcttttctttcaatccttagtcttgcaatttcgatttctgatt |
221 |
Q |
| |
|
|||| ||||||||| |||||| |||| ||||| ||||| | | ||||||| ||||||||||||||||| |||| ||| ||||||||| |||||||||| |
|
|
| T |
22656423 |
tcatcaaggatattgaggtttggtttgcaatatcaattttgtttttatgattctatttcttttctttcaaaccttcgtcgtgcaatttcaatttctgatt |
22656522 |
T |
|
| Q |
222 |
attggttaac |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
22656523 |
gttggttaac |
22656532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 16607482 - 16607445
Alignment:
| Q |
179 |
tcttttctttcaatccttagtcttgcaatttcgatttc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16607482 |
tcttttctttcaaaccttagtcttgcaatttcaatttc |
16607445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University