View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3843_high_16 (Length: 250)

Name: NF3843_high_16
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3843_high_16
NF3843_high_16
[»] chr3 (1 HSPs)
chr3 (18-236)||(37244698-37244918)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 37244918 - 37244698
Alignment:
18 ccttttctgtatcatatgtttgccacatatgagattaggaatatata--ctttttggttatttgtgtttgtccataatgacctccttgttaattatctga 115  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
37244918 ccttttctgtatcatatgtttgccacatatgagattagggatatatatactttttggttatttgtgtttgtccataatgacctccttgttaattatctga 37244819  T
116 tattatagaagtccctttttctctttttgccagcgcttttgattatagtgaagcatgtgatgagtttggttatagaactttggtattaaaatatcttaga 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244818 tattatagaagtccctttttctctttttgccagcgcttttgattatagtgaagcatgtgatgagtttggttatagaactttggtattaaaatatcttaga 37244719  T
216 gtcttagagaccactaacccc 236  Q
    ||||||||||||||| |||||    
37244718 gtcttagagaccactgacccc 37244698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University