View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_low_12 (Length: 290)
Name: NF3843_low_12
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 33294854 - 33294965
Alignment:
| Q |
14 |
gagacagaacacaaagttccaaccatgacaagacaaggagtttatgctgctttatcttatatgtcctcttcaggtttgtaa-ttttacctcttcaaacat |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33294854 |
gagacagaacacaaaggtccaaccatgacaagacaaggagtctatgctgctttatcttatatggcctcttcaggtttgtaatttttacctcttcaaacat |
33294953 |
T |
 |
| Q |
113 |
catttttctaca |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33294954 |
catttttctaca |
33294965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 213 - 274
Target Start/End: Original strand, 33294976 - 33295037
Alignment:
| Q |
213 |
gagatgaaagtgaataaaaatttcatgaagagaataattttgatataatgtgagtgtaaaaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33294976 |
gagatgaaagtgaataaaaatttcatgaagagaataattttgatataatgtgagtgtaaaaa |
33295037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University