View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_low_15 (Length: 275)
Name: NF3843_low_15
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 70
Target Start/End: Original strand, 27255057 - 27255092
Alignment:
| Q |
35 |
tcattttggtgaataatattcataggggtcaaacat |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27255057 |
tcattttggtgaataatattcataggggtcagacat |
27255092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 35305753 - 35305718
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcataggggtca |
65 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35305753 |
gtgggtcattttggtgaataatattcataggggtca |
35305718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 25597356 - 25597397
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcata-ggggtcaaacat |
70 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25597356 |
gtgggtcattttggtgaataatattcatagggggtcaaacat |
25597397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 35307193 - 35307232
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcataggggtcaaacat |
70 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
35307193 |
gtggatcattt-ggtgaataatattcataggggtcagacat |
35307232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 43631218 - 43631186
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcatagggg |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
43631218 |
gtgggtcattttggtgaataatattcatagggg |
43631186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 55536898 - 55536866
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcatagggg |
62 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
55536898 |
gtggatcattttggtgaataattttcatagggg |
55536866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 70
Target Start/End: Original strand, 39506766 - 39506801
Alignment:
| Q |
35 |
tcattttggtgaataatattcataggggtcaaacat |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39506766 |
tcattttggtgaataatattcataggggtcagacat |
39506801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 42596912 - 42596953
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcata-ggggtcaaacat |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
42596912 |
gtggattattttggtgaataatattcatagggggtcaaacat |
42596953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 62
Target Start/End: Original strand, 49914428 - 49914460
Alignment:
| Q |
30 |
gtggatcattttggtgaataatattcatagggg |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
49914428 |
gtgggtcattttggtgaataatattcatagggg |
49914460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University