View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_low_16 (Length: 258)
Name: NF3843_low_16
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 29 - 146
Target Start/End: Complemental strand, 35882417 - 35882302
Alignment:
| Q |
29 |
gaccttgtactctggagccaaaacatttttcacaatgacagagtttaaatttgatgacacggtttagtgtgtagagctccccccatatcgctcattaatt |
128 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
35882417 |
gaccttgtactctggagcccaaacatttttcacaatgacagagtttaaatctgatg--acggtgtagtgtgtagagctccccccatttcaatcattaatt |
35882320 |
T |
|
| Q |
129 |
catctatcttaacctgca |
146 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35882319 |
catctatcttaacctgca |
35882302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 113 - 209
Target Start/End: Complemental strand, 35900287 - 35900191
Alignment:
| Q |
113 |
atatcgctcattaattcatctatcttaacctgcannnnnnntgaaggataaaataccaagagaaataactgaaaacttatgagcgtttcaataaaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35900287 |
atatcgctcattaattcatctatcttaacctgcagggggagtgaaggataaaataccaagagaaataactgaaaacttatgagcgtttcaataaaag |
35900191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 245
Target Start/End: Complemental strand, 35900182 - 35900139
Alignment:
| Q |
202 |
aataaaagcccaagtagtcttggacttgtcaaccatatggagaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35900182 |
aataaaagcccaagtagtcttggacttgtcaaccatatggagaa |
35900139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 35900329 - 35900288
Alignment:
| Q |
27 |
acgaccttgtactctggagccaaaacatttttcacaatgaca |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35900329 |
acgaccttgtactctggagccaaaacatttttcacaatgaca |
35900288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 146
Target Start/End: Original strand, 10211904 - 10212016
Alignment:
| Q |
29 |
gaccttgtactctggagccaaaacatttttcacaatgacagagtttaaatttgatgacacggtttagtgtgtagagctccccccatatcgctcattaatt |
128 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| |||||| |||| |||| ||| | ||||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
10211904 |
gaccttgtacttttgagccaaaacatttttcacgatgacaaagttcaaatctgacg--tcggttta---tgtagagctccccccatttcagtcactaatt |
10211998 |
T |
|
| Q |
129 |
catctatcttaacctgca |
146 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
10211999 |
cttctatcttaacctgca |
10212016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University