View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_low_17 (Length: 257)
Name: NF3843_low_17
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 12033070 - 12032845
Alignment:
| Q |
17 |
acttaccaccttttgaatacatttacaagtctttcaacattatcatatgatacatgtcttttttattttgaggggcatatgatgtgnnnnnnnnnnnnnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
12033070 |
acttaccaccttttgaatacatttacaagtccttcaacattatcatatgatacgtgtcttttttattttgagggacatatgatgtgttttttgttttttt |
12032971 |
T |
 |
| Q |
117 |
nnaggatatgaatatgtgtttatatagtttttgtctcttcgacgtatggaatgtctactactacatatcatatgcaacaaattcttcattttccaacaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12032970 |
t-aggatatgaatatgtgtttatatagtcttcgtctcttcgacgtatggaatgtctactactacatatcatatgcaacaaattcttcattttcaaacaca |
12032872 |
T |
 |
| Q |
217 |
ccgttttatgattctcaatggcctttg |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
12032871 |
ccgttttatgattctcaatggcctttg |
12032845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University