View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3843_low_19 (Length: 251)
Name: NF3843_low_19
Description: NF3843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3843_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 35409139 - 35409365
Alignment:
| Q |
16 |
attaacaatattttttgctattcaaaaaacaaaagtaatgggaaaactaatgaaggataaccaaagtatctctaattgaagttgctttaatattgcatac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409139 |
attaacaatattttttgctattcaaaaaacaaaagtaatgggaaaactaatgaaggataaccaaagtatctctaattgaagttgctttaatattgcatac |
35409238 |
T |
|
| Q |
116 |
tcttttcattttannnnnnncacaaaaaattagcgtactcttgatcatgcaactgaatttgtagcaatttttctagcttatcacgagttatctatgcaac |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409239 |
tcttttcattttatttttttcacaaaaaattagcgtactcttgatcatgcaactgaatttgtagcaatttttctagcttatcacgagttatctatgcaac |
35409338 |
T |
|
| Q |
216 |
ttttgatataaaaagacaaagaataat |
242 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
35409339 |
ttttgatataaaaagacaatgaataat |
35409365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University