View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3844_high_4 (Length: 228)
Name: NF3844_high_4
Description: NF3844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3844_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 40179679 - 40179473
Alignment:
| Q |
1 |
gcccccctacaatgttggatttcttagcatttggtgctttgaatgcactgttaaccatatttccattcatgtttgtctcattgttttcctcctcagtgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40179679 |
gcccccctacaatgttggatttcttagcatttggtgctttgaatggactgttaaccata---------atgtttgtctcattgttttcctcctcagtgct |
40179589 |
T |
 |
| Q |
101 |
ccattccattttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcacaccttcaactgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40179588 |
ccattccattttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcacaccttcaacttga |
40179489 |
T |
 |
| Q |
201 |
tcaccattctctgctc |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40179488 |
tcaccattctctgctc |
40179473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University