View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3845_high_17 (Length: 250)
Name: NF3845_high_17
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3845_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34462485 - 34462570
Alignment:
| Q |
1 |
atgaacttgcttttctgtcgtggctttgattgtgattaccatattcatttttaaccttttatcctatatcctaattagtggaggctttt |
89 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34462485 |
atgaactagcttttctgtcgtggctttgattgtgattaccatattca---ttaaccttttatcctatatcctaattagtggaggctttt |
34462570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 160
Target Start/End: Original strand, 34462567 - 34462608
Alignment:
| Q |
119 |
ttttcattgtttgaccaaattaggcatactattaaagataat |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34462567 |
ttttcattgtttgaacaaattaggcatactattaaagataat |
34462608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University