View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3845_high_24 (Length: 235)
Name: NF3845_high_24
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3845_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 4702795 - 4702852
Alignment:
| Q |
1 |
ttatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagtttt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
4702795 |
ttatgatctgctctcaaatattgcaaataggctggaactgattga-ttttaccagtttt |
4702852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 4706162 - 4706222
Alignment:
| Q |
1 |
ttatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagttttcat |
62 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
4706162 |
ttatgatctgctgtcaaatattgcaaataggctggaactgattga-ttttacctgttttcat |
4706222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 87 - 139
Target Start/End: Original strand, 4706506 - 4706558
Alignment:
| Q |
87 |
atgactgtattgcagcattttcatctgctcctacatctcaggattgcattgtt |
139 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
4706506 |
atgactatattgcagcaatttcatctgctcccacatctcaggattgtattgtt |
4706558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University