View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3845_low_16 (Length: 300)
Name: NF3845_low_16
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3845_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 64 - 282
Target Start/End: Original strand, 4680293 - 4680510
Alignment:
| Q |
64 |
catagtgaacaaaactattattcaattttggtctcatcattagtcgtgtgtcccagttattttctctttggacaataaacgtcagggtgggttgttttgt |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680293 |
catagtgaacaaa-ctattattcaattttggtctcatcattagtcgtgtgtcccagttattttctctttggacaataaacgtcagggtgggttgttttgt |
4680391 |
T |
|
| Q |
164 |
tgtaacaatagacaagttttgtgtaatctaatgtattgatttgtacaatcaacttttattcttgagccatacatcctttgtttctttaaccttcaagtag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680392 |
tgtaacaatagacaagttttgtgtaatctaatgtattgatttgtacaatcaacttttattcttgagccatacatcctttgtttctttaaccttcaagtag |
4680491 |
T |
|
| Q |
264 |
ttgctaacaaaactaaaac |
282 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4680492 |
ttgctaacaaaactaaaac |
4680510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University