View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3845_low_18 (Length: 250)

Name: NF3845_low_18
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3845_low_18
NF3845_low_18
[»] chr1 (2 HSPs)
chr1 (1-89)||(34462485-34462570)
chr1 (119-160)||(34462567-34462608)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34462485 - 34462570
Alignment:
1 atgaacttgcttttctgtcgtggctttgattgtgattaccatattcatttttaaccttttatcctatatcctaattagtggaggctttt 89  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||    
34462485 atgaactagcttttctgtcgtggctttgattgtgattaccatattca---ttaaccttttatcctatatcctaattagtggaggctttt 34462570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 160
Target Start/End: Original strand, 34462567 - 34462608
Alignment:
119 ttttcattgtttgaccaaattaggcatactattaaagataat 160  Q
    |||||||||||||| |||||||||||||||||||||||||||    
34462567 ttttcattgtttgaacaaattaggcatactattaaagataat 34462608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University